• Customer Support: admin@thealgorists.com
  • Feedback: We are listening to your every feedback, and taking action to constantly improve your learning experience. If you have any feedback, please use this form: https://thealgorists.com/Feedback.



Problem Statement:


All DNA is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T', for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

Example 1:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:
Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]

Solution:



Algorithm:



This is a Premium content.
Please subscribe to the Algorithms course to access the detailed Algorithm discussion.



Java Solution:



This is a Premium content.
Please subscribe to Algorithms course to access the code.





Python Solution:



This is a Premium content.
Please subscribe to Algorithms course to access the code.







The above content is written by:

Abhishek Dey

Abhishek Dey

A Visionary Software Engineer With A Mission To Empower Every Person & Every Organization On The Planet To Achieve More

Microsoft | University of Florida

View LinkedIn profile


If you have any feedback, please use this form: https://thealgorists.com/Feedback.




Subscribe to Our Youtube Channel

Follow Us On LinkedIn
wave